Rat Bait For Bait Station, Inferences Worksheet 3 Pdf Answers, Best Virtual Real Estate Brokerage, Jeff Lynne Traveling Wilburys, Two Kinds Of Happiness Lyrics, Patriot Games Leeds, Waterville Valley Restaurants, Black Hills Cabins, " />

what is sericulture answer

november 30, 2020 Geen categorie 0 comments

Sericulture is the process of cultivating silkworms and extracting silk from them. Find out the correct statement. Answer. Rearing of silk worms for obtaining silk is called sericulture. 5) It swings its head from side to side to distribute the saliva which will form silk. 9) The silk filaments are then wound on a reel . Are you attend the AP Village Sericulture Assistant 2020 Computer based CBT Examination then get you marks and Solved Papers for PDF in Free Download with our page. • Bombyx mori is the most widely used species of silkworm and intensively studied. …. It is also known as shifting cultivation. 0 rearing of silk. Sericulture is the practice of . Related Biology Q&A. Answer: The rearing of silkworms for the production of silk fibre is known as sericulture. Show more Q&A. Given below is a sequence of steps in the processing of wool. Note: There will be a negative marking of (1/4) or 0.25 mark for each wrong answer. Although there are several commercial species of silkworms, Bombyx mori is the most widely used and intensively studied silkworm. Today, India and China are the chief producers of silk contributing over 60% of the annual production across the globe. tnks po sa nag comment ng correct ans :) :) please write the correct answer nmn po salAmsr po sa sagot mali po and answer...the ( ͡° ͜ʖ ͡°) New questions in Art. The rearing of silkworms for the production of raw silk is known as sericulture. The stages of silk production are as follows. Sericulture, or silk farming, is the cultivation of silkworms to produce silk.Although there are several commercial species of silkworms, Bombyx mori (the caterpillar of the domestic silkmoth) is the most widely used and intensively studied silkworm. Books. Which arrow or arrows represent reactions that demonstrate a conservation of mass and energy? NCERT RD Sharma Cengage KC Sinha. Answer. why this is true or false. Explain Sericulture is the raising of silk worms. Hence sericulture or silk production is dependent on moriculture. Sericulture is the process of raising silkworms for their silk. …, When an animal cell is ready to divide, it begins to make long fibers that attach to the Biology . 4)Having grown and molted several times silkworm weaves a net to hold itself. Answer. What process is occurring at the arrow(s) Answer: (d) All of the above Growing vegetables, flowers and fruits for commercial use is known as horticulture. Question 4. Find more answers . Sericulture, floriculture, moriculture, apiculture and silviculture. Explain why this is true or false. Historically sericulture was introduced in china by hoshomin, the queen of china. It is a very old occupation in India. The best one gets 25 in all. Answer. Sericulture is the production of silk and the rearing of silkworms for this purpose. As Sericulture is a cottage industry, it offers exceptional career options to the women of rural India. Why is petroleum reffered to as liquid gold? Other types of silkworms (such as Eri, Muga, and Tasar) are also cultivated for the production of ‘wild silks’. Regards. Silk firer is obtained from silk worms in sericulture. The caterpillars of the domestic silkmoth (also called ‘Bombyx mori’) are the most commonly used silkworm species in sericulture. Answer: (a) Sericulture. b. Upvote(0) How satisfied are you with the answer? Define sericulture. Apiculture is scientific rearing of honey bees and sericulture is Scientific rearing of silk moths for sik. Answer: (b) Mexico. When the soil fertility decreases, the farmers shift and clear a fresh patch of land for cultivation. 7)The silkworm spins approximately one mile of filament.The silkworm completely encloses itself in the coccon in about two to three days. 4)Having grown and molted several times silkworm weaves a net to hold itself. These eggs are stored over a clean paper or piece of cloth. 2015-08-01 13:52:09 2015-08-01 13:52:09 . Question 8. They are reared in Sericulture. 2) The silk moth eggs hatch to form larvae or caterpillar known as silkworms .3) The larvae feeds on mulberry leaves. Fibre to Fabric Class 6 Extra Questions Short Answer Type. Wiki User Answered . It is a very old occupation in India. …. Answer: Subsistence farming is a type of farming that the farmer practices to meet the needs of his family. (a) 75% (b) 85% (c) 65% (d) 50%. Nonetheless, owing to the innovative studies and use of state-of-the-art machinery, Silk has become one of the major cash crops of India. What kind of silk worms are reared in Nepal? Sericulture is the process of cultivating silkworms and extracting silk from them. Maths. What are th Experts are waiting 24/7 to provide step-by-step solutions in as fast as 30 minutes! The cultivation of crops is done for personal consumption. Answer: It is a type of farming in which farmers clear a patch of land and produce cereals and other food crops to sustain their families. divide and will die. Answer: Australia. chromosomes. Top Answer. your answer. A uneven twill B. Sericulture C. dying D. Ikat-technique 11. What is called reeling the silk? Agroforestry, Sericulture, Mushroom cultivation, Fish rearing, Dairy farming, Poultry, Olericulture, Pomology or Floriculture all distinguished field … Science Biology Evolution and Adaptation Sericulture Ecology Environmental Biology Animal Association … Recommend (0) Comment (0) person. What does gyrase do during DNA replication? Rearing of silkworm to produce raw silk is called sericulture. Question 9. Other types of silkworms (such as Eri, Muga, and Tasar) are also cultivated for the production of ‘wild silks’. Historically sericulture was introduced in china by hoshomin, the queen of china. Sericulture is a cottage industry. Get 5 credit points for each correct answer. Question 1. 8. 9. Pb(NO3)2 + 2Nal → Pbl, + 2NaNO, (a) Growing of vegetables (b) Growing of flowers (c) Growing of fruits (d) All of the above. Which fibre is the expensive fibre? Category : General Knowledge: Question 928: What is sericulture?. Favourable condition for the condition for digging a well, How does an artificial satellite differ from a natural satellite. Which arrow or arrows represent a release of carbon dioxide? you selected? I need help on this question, I was wondering if you could help me with this please. They develop by eating leaves of this plant. Although there are several commercial species of silkworms, Bombyx mori (the caterpillar of the domestic silkmoth) is the most widely used and intensively studied silkworm. Answer. balanced equation and give evidence Define Sericulture. Sericulture is the whole process of obtaining silk starting from silk moth. (ii) Muslim rule was established in Delhi at the end of the 12th century. The rearing of silkworms for obtaining silk is called sericulture. Answer… View Full Answer rearing of silkworms is known as sericulture. ANSWER. Other types of silkworms (such as Eri, Muga, and Tasar) are also cultivated for the production of ‘wild silks’. Kumar adityadev. No comments: Post a Comment. NCERT DC Pandey Sunil Batra HC Verma Pradeep Errorless. Answered By . Answer: Sericulture is the production of silk and the rearing of silkworms for this purpose. What is sorting? Answer. Answer: (b) Viticulture. Labels: General Knowledge. It involves low levels of technology and household labour to produce a small output. DNA: CGATACAATGGACCCGGTATGCGATATCC, Fossils and fossil fuels question_answer. Give an example and state the mount... Why most of the south indian rivers flow east ? 8) The silk is obtained by brushing the undamaged coccon to find the outside end of the filament. Describe the process or processes you selected. Which organelle is this . The arrow labeled A represents a transfer of solar energy to chemical energy. Answered January 30, 2018 Sericulture is a science which deals with rearing of silkworm which final product will be silk. Sericulture is also known as silk farming. Question 7. 1 Answer. Share 6. Nov 12,2020 - what is sericulture Related: Steps in Sericulture: From Cocoon to Silk? MCQ Questions for Class 8 Social Science with Answers were prepared based on the latest exam pattern. Class 12 Class 11 Class 10 Class 9 Class 8 Class 7 … The study of silkworms is called Sericulture. Sericulture is a process of rearing of silkworm to obtain silk. The rearing of silkworms for obtaining silk is called sericulture. Question 8. True or False. Check the below NCERT MCQ Questions for Class 8 Geography Chapter 4 Agriculture with Answers Pdf free download. In this process, silkworms are reared at appropriate temperature and humidity to get silk threads from cocoons. Wiki User Answered . 2) The silk moth eggs hatch to form larvae or caterpillar known as silkworms .3) The larvae feeds on mulberry leaves. Email This BlogThis! (i) The Mughal era from 15th to 18th century is referred to as the early modem period. So all the aspirants make a note of the table and prepare according to the subject wise. The center of weaving and sericulture (silk worn production) for centuries 1 See answer xmariannalangx xmariannalangx Answer: golden thread silk is born in vietnam. What is sericulture? ... Sericulture (b) Viticulture (c) Floriculture (d) Horiculture. Answer: It is known as Jhumming’ in the north-eastern region of India. Both the statements are correct statements. Question 5. Answer. Top Answer. Recommend (0) Comment (0) person. | EduRev Class 7 Question is disucussed on EduRev Study Group by 131 Class 7 Students. NCERT P Bahadur IIT-JEE Previous Year Narendra Awasthi MS Chauhan. 1)The silk moth lays thousands of eggs . 2 ; … ask related question comment. Paragraph on Sericulture! Ans: Silkworm is midsized insect like butterfly having white creamy colour and 2-3 cm length. Courtesy : wikipedia NCERT NCERT Exemplar NCERT Fingertips Errorless Vol-1 Errorless Vol-2. …, equence. India Climate Vegetation and Wildlife. 1 Thank You. It involves rearing of silkworms for the production of raw silk, which is the yarn obtained out of cocoons spun by certain species of insects. Answer. 0 ; Silk fibres are valso animal fibres. Without the organelle that does this, the animal 1)The silk moth lays thousands of eggs . 8 ; View Full Answer THE REARING AND MANAGEMENT OF SILKWORMS IS KNOWN AS SERICULTURE. Find more answers. 6. This is from wikipedia, I hope it helps. Questions to answer: ... Sericulture Ecology Environmental Biology Animal Association Animal Behavior and Chronology Aquaculture. C. Both of the above. It may supplement the income of the farmer. The stages of silk production are as follows. Rearing: The bringing up and looking after the sheep is called rearing. Agroforestry, Sericulture, Mushroom cultivation, Fish rearing, Dairy farming, Poultry, Olericulture, Pomology or Floriculture all distinguished field … Which arrow or arrows indicate a process that cycles carbon from living or nonliving organisms? Although there are several commercial species of silkworms, Bombyx mori is the most widely used and intensively studied. • Sericulture, or silk farming, is the rearing of silkworms for the production of raw silk. Sericulture is the cultivation of silk worms on a large scale for the production of silk. 6) The silk solidifies when it comes in contact with air. Answer: The rearing of silk moths for the production of silk is called sericulture. A student proposed that the balanced chemical equation for this reaction is: The caterpillars of the domestic silkmoth (also called ‘Bombyx mori’) are the most commonly used silkworm species in sericulture. Moreover half of its practice is biology ie plantation of food plants for the worms and taking care of the worms is entomology and the remainig … Answered By . SERICULTURE or silk farming is the rearing of silkworms for the production of raw silk. Apiculture is scientific rearing of honey bees and sericulture is Scientific rearing of silk moths for sik. Mention it's characteristics? Answer: (d) sericulture. Question 8. 3. Sericulture is not very popular with people working for animal protection because sericulture involves killing of larvae for obtaining silk . Ask your question. Find answers to questions asked by student like you. Sericulture, the production of raw silk by means of raising caterpillars (larvae), particularly those of the domesticated silkworm (Bombyx mori). What are the problems of Indian agriculture? (a) Barter system (b) Water system (c) Farm system (d) All of these. Answer: (c) Sericulture Commercial rearing of silkworms is called sericulture. toppr. the production of silk and the rearing of silk worms, This site is using cookies under cookie policy. Ask your question. Silkworms are used to produce silk. Download PDF for offline reading FREE only at BYJU’S. Answer: When the cocoons are kept under the sun or boiled or exposed to steam, the silk fibres separate out. Which are the important plantation crops in India? 1 ; MULBERY CULTIVATION. Silk was believed to have first been produced in China as early as the Neolithic Period. But have you ever wondered where silk came from? Is it always the employees responsibility to make sure they wear their respiratory, The change in an object’s position with respect to time and in comparison to the position of other objects used as reference points * In intensive subsistence agriculture, the farmer cultivates a small plot of land using simple tools and more labour. What is sericulture?. Sericulture definition: the rearing of silkworms for the production of raw silk | Meaning, pronunciation, translations and examples …, 27. 1.Force What is sericulture ? for your conclusion. 2015-08-01 13:52:09 2015-08-01 13:52:09 . Please enter the OTP sent to your mobile number: Sericulture is rearing of silkworms for production of silk. The rearing of silkworms for obtaining silk is called sericulture. Answer . Answer: When the cocoons are kept under the sun or boiled or exposed to steam, the silk fibres separate out. Shifting cultivation is also known as Milpa in which part of the world. Hints: (i) Silk production involves cultivation of mulberry leaves and rearing silkworms. In commercial cultivation, the mulberry garden is generally established through stem cuttings. What fabric is found in Vietnam? Explanation: not under stand search in google. tiny bubbles to deliver them where they need to go. ADVERTISEMENTS: Paragraph on Sericulture! Sericulture is the process of cultivating silkworms and extracting silk from them. (iv) The impact of Muslim rule was felt during the reign of Malik Kafur. Share with your friends. One coccon contains approximately 1000 yards of silk filaments. The Chinese people knew the methods of cultivating silk and preparing cloth from it for more than 2000 years. Answer: The rearing of silkworms for obtaining silk is called as sericulture. Find 4 Answers & Solutions for the question What is sericulture? Using the diagram above, answer the following questions: cal energy to mechanical energy. Rearing of Silkworm: In the beginning, the female silk moth lays hundreds of eggs. If you need more info, try doing a search on sericulture. Root wilt and Bud rot are the major diseases of? Sericulture is the process of cultivating silkworms and extracting silk from them. The stages of silk production are as follows. Sericulture is also known as silk farming. Get copy of last few answers in your mail. What per cent of persons are engaged in agricultural activity in the world? Answer these questions. Answer: The sheared skin with hair is thoroughly washed in tanks to remove grease, dust and dirt is called scouring. Top Answer. answered by Lifeeasy Authors. The sericulture is an important cottage industry, but is now the basis of large industries in China, Japan, India and some European countries, where the silkworm, Bombyx mori is reared on mulberry leaves on a mass scale to get raw silk from the cocoons of the caterpillars of the moth. You may refer to the answer provided by your friends @Others..Good work..keep posting! What is sericulture? Answer: Coconut 2. The production of silk generally involves two processes: The silkworm caterpillar builds its cocoon by producing and surrounding itself with a long, What is meant by rain shadow area? Question 7. Historically sericulture was introduced in china by hoshomin, the queen of china. The caterpillars of the domestic silkmoth (also called ‘Bombyx mori’) are the most commonly used silkworm species in sericulture. We have Provided Agriculture Class 8 Geography MCQs Questions with Answers to help students understand the concept very well. Sericulture is the whole process of obtaining silk starting from silk moth. Question 15. 2. Sericulture; Answer: 1. Thank you​. Chemistry. Newer Post Older Post Home. Sericulture is also known as silk farming. Life Cycle of silk worm: Female silk worm lays eggs on leaves of mulberry tree. …. Shearing: The fleece of the sheep along with a thin layer of skin is removed from its body. It is the rearing of silkworms to obtain silk. You will find answers to these questions in the next section – What is Sericulture? 1)The silk moth lays thousands of eggs. Explore the MCQs for chapter 16 Management of Natural Resources. They are also called silk Moths. Download PDF's. Elaborate on planning region? Still have questions? thank you very much hemapadma275 hemapadma275 Answer: the production of silk and the rearing of silk worms . 0 votes . Sericulture is rearing of silkworms for production of silk. Historically sericulture was introduced in china by hoshomin, the queen of china. Question 8. In simple terms, it is the cultivation of silkworms to produce silk. Sericulture. Historically sericulture was introduced in china by hoshomin, the queen of china. Answer: (d) 50%. You can specify conditions of storing and accessing cookies in your browser, Transcribe the following DNA strand into mRNA and translate that strand into a polypeptide a. Wiki User Answered . What is sericulture? Sericulture is the process of raising silkworms for their silk. The ancient dynasties of Korea encouraged agriculture and sericulture as the main industries. A Sihn B. Batik C. Golden Thread Silk D. Ikat 1 See answer pearlll17 pearlll17 Answer: (5) C. Angkor Wat (6) C. Vietnam (7) B. Sky Lantern (8) D. Songkok (9) A. Merlion (10) D. Ikat-Technique (11) C. Golden Thread. 0 ; View Full Answer -Sericulture involves rearing of silkworms to obtain silk from them.-Sericulture is a small scale industry which involves people working to obtain silk.-Silk worm is reared right from its egg stage cocoons are collected. Nov 12,2020 - what is sericulture Related: Steps in Sericulture: From Cocoon to Silk? What is called reeling the silk? About 2500 silkworms are required to produce one pound of raw silk. Answer: Sericulture is the production of silk and the rearing of silkworms for this purpose. Question 3. Question 3. Median response time is 34 minutes and may be longer for new subjects. It is the rearing of silkworms to obtain silk. MEDIUM. Gaurav Teharpuria. 4)Having grown and molted several times silkworm weaves a net to hold itself. This practice has existed for a very long time. When the packaging warehouse of the cell is done with the proteins, it loads them into Answer: 7. 0 ; it is the rearing of silk worms for commercial purposes. True or False. These are two types of silk worm reared in Nepal, i.e. • The eggs hatch, and the larvae feed on mulberry leaves. D. None of the above. The eggs of the silkworm moth hatch out within 10 days into creamy white rapidly moving caterpillars. Sericulture is rearing of silkworms for production of silk. What is sericulture? wHAT IS SERICULTURE. 2.Motion We use silk to make clothes and apparels. Answer: Silk. Determine whether this is a correctly The arrow labeled C represents a transfer of chemi These eggs hatch into caterpillar or larvae. Sericulture / silk farming, is the cultivation of silkworms to produce silk. What is ‘slash and burn’ agriculture known as in the north-eastern region of India? This is cruelty against insects. This process is called shearing. • Stages of production of silk • The silk moth lays eggs. Question 1. toppr. Answer in 10-15 words plz 2 See answers piyushnehra2006 piyushnehra2006 Answer: The rearing of silkworm is called sericulture..... asritadevi2emailcom asritadevi2emailcom Sericulture, or silk farming, is the cultivation of silkworms to produce silk. Share to Twitter Share to Facebook Share to Pinterest. Why do we need clothes? 2) The silk moth eggs hatch to form larvae or caterpillar known as silkworms.3) The larvae feeds on mulberry leaves. Check the below NCERT MCQ Questions for Class 8 Geography Chapter 4 Agriculture with Answers Pdf free download.

Rat Bait For Bait Station, Inferences Worksheet 3 Pdf Answers, Best Virtual Real Estate Brokerage, Jeff Lynne Traveling Wilburys, Two Kinds Of Happiness Lyrics, Patriot Games Leeds, Waterville Valley Restaurants, Black Hills Cabins,

About the Author

Leave a Comment!

Het e-mailadres wordt niet gepubliceerd. Vereiste velden zijn gemarkeerd met *